녹아웃(KO) 마우스 | Cyagen Korea

Name: NOD/Shi-Prkdcscid Il2rgem1/Cgen

Abbreviation: C-NKG 마우스

Background strain: NOD/Shi-Scid

 

NKG 마우스는 Cyagen에서 CRISPR/Cas9기술을 사용하여 NOD/Shi-Scid strain의 마우스에서 Il2rg 유전자를 Knock-Out 시킨 중증면역결핍 마우스이다. NKG 마우스는 성숙한 T, B, NK세포가 결핍하며, 보체 활성 감소, 대식세포가 인체 세포 포식 작용이 약하며, 고효율적으로 조혈모세포, 말초 혈액 단핵세포, PDX 또는 성체 줄기세포 이식이 가능하다. 지금까지 공인된 면역결핍 정도가 높고 종양, 면역, 자가면역 질병, 면역 치료 백신, GvHD/ 이식, 안전성평가 등 연구에 사용되는 모델이다.

 

특징:

 

  • 성숙한 T, B, NK세포가 결핍
  • 보체 활성 감소
  • 대식세포와 수지상세포 기능 이상
  • T,B 세포 재생성 가능성 적음
  • 림프종양 발병 가능성 적음(NOD scid와 다름),장기적 실험과 단기적 실험에 사용 가능
  • 당뇨병으로 발병하지 않음
  • NOD/scid와 비교하면 이식한 인체 세포 혹은 조직의 생존율이 높음, 더 많은 양의 인체 조직 이식 가능.

 

Phenotypic verification:

 

1. Prkdc 유전자 돌연변이

 

MT: TAACGGAAAAGAATTGGTATCCACAACATAAAATACGCTAAGCTAAGAGAAAGTTAGCAGGGGCCAACCCAGCTGTTATA

 

  

그림 1. Prkdcscid  돌연변이는 Prkdc유전자 84번 exon에 TAT→TAA로 변한 것이다, 유전자 시퀀싱을 보면 NKG 마우스는 Prkdcscid 돌연변이를 가지고 있다.

 

2. Il2rg유전자 Knock-Out

 

 

 

그림 2. NKG 마우스 Il2rg 유전자에 대하여 PCR을 진행한 결과 성공적으로 삭제되었다. 야생형 부분:388bp;Knock-Out 부분:1430bp

 

3. C-NKG 마우스 말초 혈액 B, T, NK세포 검사

  

 

 

그림 3. C-NKG 마우스 말초 혈액 중 B, T, NK세포 결실로 중증 면역결핍 마우스이다.

BALB/c, C-NKG 마우스의 말초 혈액을 취하여 B, T, NK세포를 검사한 결과 C-NKG 마우스는 BALB/c 마우스보다 B세포(CD3-CD19+), T세포(CD3+CD19-), 보조성 T세포(CD3+CD4+CD8-), 세포독성 T세포(CD3+CD4-CD8+), NK세포(CD335+CD3-)가 심각하게 결실되었다.

 

4. C-NKG 마우스 림프 조직 B, T, NK세포 검사

 

그림 4. C-NKG 마우스 림프 조직 중 B, T, NK세포 결실로 중증 면역결핍 마우스이다.

BALB/c, C-NKG 마우스의 림프 조직을 취하여 B, T, NK세포를 검사한 결과 C-NKG 마우스는 BALB/c 마우스보다 B세포(CD3-CD19+), T세포(CD3+CD19-), 보조성 T세포(CD3+CD4+CD8-), 세포독성 T세포(CD3+CD4-CD8+), NK세포(CD335+CD3-)가 심각하게 결실되었다.

  • Contact Us

    영업일 기준 1-2일 내에 답변해 드리겠습니다.

    *

    The username is required

    *

    The user's email is required

    Please enter a valid email address.

    *

    The content is required

    *
  • New Product Launch